one- or two-way anova Search Results


94
OriGene nova2 human untagged
(A) Schematic representation of the <t>NOVA2</t> Human Untagged Clone (#SC303210, OriGene) containing the full-length NOVA2 cDNA (NM_002516) that we modified by inserting a 14×His-tag in-frame at the C-terminus of the NOVA2 open reading frame. The scheme illustrates the NOVA2 coding sequence (yellow), the inserted 14×His-tag (orange), followed by the stop codon (red). (B) hNSC co-overexpressing the non-pathogenic N(ATTTT) 7 , N(ATTTT) 139 or the pathogenic Ins(ATTTC) 58 sequences and NOVA2-His-tag, show aberrant nuclear AUUUC repeat aggregates that colocalize with NOVA2 (white arrows), but not AUUUU repeat accumulation, after staining with a specific FISH probe followed by immunofluorescence with the Anti-his-tag antibody, visible at 48 hours post-transfection. GFP expression was used as a marker for transfection. Images acquired in Leica Microsystems TCS SP5 II confocal microscope, using a HC PL APO Lbl. Blue 63× /1.40 Oil objective with 8× zoom. Scale bar = 2 µm.
Nova2 Human Untagged, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/one-+or+two-way+anova/NOVA2+(NM_002516)+Human+Untagged+Clone/bio_rxiv__2025__09__03__673996-79-7-12
Average 94 stars, based on 1 article reviews
nova2 human untagged - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

93
Proteintech nova2
(A) Schematic representation of the <t>NOVA2</t> Human Untagged Clone (#SC303210, OriGene) containing the full-length NOVA2 cDNA (NM_002516) that we modified by inserting a 14×His-tag in-frame at the C-terminus of the NOVA2 open reading frame. The scheme illustrates the NOVA2 coding sequence (yellow), the inserted 14×His-tag (orange), followed by the stop codon (red). (B) hNSC co-overexpressing the non-pathogenic N(ATTTT) 7 , N(ATTTT) 139 or the pathogenic Ins(ATTTC) 58 sequences and NOVA2-His-tag, show aberrant nuclear AUUUC repeat aggregates that colocalize with NOVA2 (white arrows), but not AUUUU repeat accumulation, after staining with a specific FISH probe followed by immunofluorescence with the Anti-his-tag antibody, visible at 48 hours post-transfection. GFP expression was used as a marker for transfection. Images acquired in Leica Microsystems TCS SP5 II confocal microscope, using a HC PL APO Lbl. Blue 63× /1.40 Oil objective with 8× zoom. Scale bar = 2 µm.
Nova2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/one-+or+two-way+anova/NOVA2+Antibody/pmc09500891-59-14-15
Average 93 stars, based on 1 article reviews
nova2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
OriGene rc216200l2v pcdna3 bk gfp li
KEY RESOURCES TABLE
Rc216200l2v Pcdna3 Bk Gfp Li, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/one-+or+two-way+anova/NOVA2+(NM_002516)+Human+Tagged+ORF+Clone+Lentiviral+Particle/pmc09310388-1098-115-112
Average 90 stars, based on 1 article reviews
rc216200l2v pcdna3 bk gfp li - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
OriGene nova2 vectors
Fig. 3 MiR-7-5p directly targets <t>NOVA2</t> expression. a – The sequence of human miR-7-p and the predicted binding sites with miR-7-5p within the NOVA2 untranslated region (3′-UTR) are shown. b – MiR-7-5p treatment suppressed NOVA2 expression in A549 and SPCA-1 cells. The cells were cultured with or without miR-7-5p for 24 h, and then collected and used for western blotting assays to determine NOVA2 expression. β-actin was set as a loading control. The quantitative data from western blotting assays were measured with ImageJ software. Data are ratios of NOVA2 to β-actin. c – MiR-7-5p stimulation inhibited NOVA2 mRNA in A549 and SPCA-1 cells. A549 cells were co-transfected with luciferase plasmids containing the wild-type (WT) NOVA2 3′-UTR or mutant-type (Mut) NOVA2 3′-UTR. The cells were also treated with miR-7-5p at the same time. The cells were lysed to measure the relative luciferase activity. Quantitative data are presented as the means ± SEM, n = 3. ***p < 0.001 compared with the NC mimic group. d – NOVA2 expression in NSCLC tissues and adjacent non-tumor tissues was measured using qPCR. Quantitative data are presented as the means ± SEM. ***p < 0.001 compared with the NC mimic group. e – NOVA2 expression in a panel of human lung cell lines and human lung epithelial BEAS-2B cells. NOVA2 expression in BEAS-2B cells was set as 100%. Quantitative data are presented as the means ± SEM, n = 3. ***p < 0.001 compared with the BEAS- 2B group. f – Analysis of the correlation between miR-7-5p and NOVA2 expression in tumors. NOVA2 expression was inversely correlated with miR-7-5p expression in NSCLC tissues. The miR-206 mRNA level was set as the X axes, and the TFR1 mRNA level was set as the Y axes. R stands for goodness of fit. The p value stands for slope significance
Nova2 Vectors, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/one-+or+two-way+anova/NOVA2+(NM_002516)+Human+3'+UTR+Clone/pm31832068-57-3-8
Average 93 stars, based on 1 article reviews
nova2 vectors - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
OriGene rc216200l1v
KEY RESOURCES TABLE
Rc216200l1v, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/one-+or+two-way+anova/NOVA2+(NM_002516)+Human+Tagged+ORF+Clone+Lentiviral+Particle/pmc09310388-1098-114-112
Average 90 stars, based on 1 article reviews
rc216200l1v - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

91
Boster Bio anti nova2
KEY RESOURCES TABLE
Anti Nova2, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/one-+or+two-way+anova/Anti-NOVA2+Antibody+Picoband/pmc09663674-68-14-16
Average 91 stars, based on 1 article reviews
anti nova2 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

94
Boster Bio anti nubpl antibody
Fig. 2. Identification of DE-DRMs in individuals with EP. (A) The heatmap of expression levels for nine DE-DRMs. (B) The expression levels of 11 DRMs were exhibited between Ctrl and EP groups in boxplots. (C) Correlation analysis of nine DE-DRMs. Red and green colors represent positive and negative correlations, respectively. (D) The PPI analysis of DE-DMRs showed that SLC3A2 interacted with SLC7A11, while NDUFS1 interacted <t>with</t> <t>NDUFA11,</t> <t>NUBPL,</t> and LRPPRC. Abbreviations: DE-DRMs, differentially expressed disulfidptosis-related molecules; EP, epilepsy; Ctrl, control; PPI, protein-protein interaction; SLC3A2, solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; LRPPRC, leucine rich pentatricopeptide repeat containing. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Anti Nubpl Antibody, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/one-+or+two-way+anova/Anti-NUBPL+Antibody+Picoband/pm39805370-128-47-49
Average 94 stars, based on 1 article reviews
anti nubpl antibody - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

86
Minitab Inc variance anova
Fig. 2. Identification of DE-DRMs in individuals with EP. (A) The heatmap of expression levels for nine DE-DRMs. (B) The expression levels of 11 DRMs were exhibited between Ctrl and EP groups in boxplots. (C) Correlation analysis of nine DE-DRMs. Red and green colors represent positive and negative correlations, respectively. (D) The PPI analysis of DE-DMRs showed that SLC3A2 interacted with SLC7A11, while NDUFS1 interacted <t>with</t> <t>NDUFA11,</t> <t>NUBPL,</t> and LRPPRC. Abbreviations: DE-DRMs, differentially expressed disulfidptosis-related molecules; EP, epilepsy; Ctrl, control; PPI, protein-protein interaction; SLC3A2, solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; LRPPRC, leucine rich pentatricopeptide repeat containing. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Variance Anova, supplied by Minitab Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/one-+or+two-way+anova/anova+variance/10__3934_slash_agrfood__2022027-137-4-9
Average 86 stars, based on 1 article reviews
variance anova - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
OriginLab corp paired comparison app (two-way anova)
Fig. 2. Identification of DE-DRMs in individuals with EP. (A) The heatmap of expression levels for nine DE-DRMs. (B) The expression levels of 11 DRMs were exhibited between Ctrl and EP groups in boxplots. (C) Correlation analysis of nine DE-DRMs. Red and green colors represent positive and negative correlations, respectively. (D) The PPI analysis of DE-DMRs showed that SLC3A2 interacted with SLC7A11, while NDUFS1 interacted <t>with</t> <t>NDUFA11,</t> <t>NUBPL,</t> and LRPPRC. Abbreviations: DE-DRMs, differentially expressed disulfidptosis-related molecules; EP, epilepsy; Ctrl, control; PPI, protein-protein interaction; SLC3A2, solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; LRPPRC, leucine rich pentatricopeptide repeat containing. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Paired Comparison App (Two Way Anova), supplied by OriginLab corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/one-+or+two-way+anova/paired+comparison+app++two+way+anova+/pm37628061-126-18-28
Average 90 stars, based on 1 article reviews
paired comparison app (two-way anova) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriginLab corp oneway anova origin_7.0 sr0
Fig. 2. Identification of DE-DRMs in individuals with EP. (A) The heatmap of expression levels for nine DE-DRMs. (B) The expression levels of 11 DRMs were exhibited between Ctrl and EP groups in boxplots. (C) Correlation analysis of nine DE-DRMs. Red and green colors represent positive and negative correlations, respectively. (D) The PPI analysis of DE-DMRs showed that SLC3A2 interacted with SLC7A11, while NDUFS1 interacted <t>with</t> <t>NDUFA11,</t> <t>NUBPL,</t> and LRPPRC. Abbreviations: DE-DRMs, differentially expressed disulfidptosis-related molecules; EP, epilepsy; Ctrl, control; PPI, protein-protein interaction; SLC3A2, solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; LRPPRC, leucine rich pentatricopeptide repeat containing. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Oneway Anova Origin 7.0 Sr0, supplied by OriginLab corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/one-+or+two-way+anova/one+way+anova+originpro+9+0+0/pm29022867-119-6-10
Average 90 stars, based on 1 article reviews
oneway anova origin_7.0 sr0 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
statpoint inc anova statgraphics centurion
Fig. 2. Identification of DE-DRMs in individuals with EP. (A) The heatmap of expression levels for nine DE-DRMs. (B) The expression levels of 11 DRMs were exhibited between Ctrl and EP groups in boxplots. (C) Correlation analysis of nine DE-DRMs. Red and green colors represent positive and negative correlations, respectively. (D) The PPI analysis of DE-DMRs showed that SLC3A2 interacted with SLC7A11, while NDUFS1 interacted <t>with</t> <t>NDUFA11,</t> <t>NUBPL,</t> and LRPPRC. Abbreviations: DE-DRMs, differentially expressed disulfidptosis-related molecules; EP, epilepsy; Ctrl, control; PPI, protein-protein interaction; SLC3A2, solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; LRPPRC, leucine rich pentatricopeptide repeat containing. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Anova Statgraphics Centurion, supplied by statpoint inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/one-+or+two-way+anova/anova+statgraphics+18/pm25442516-83-1-2
Average 90 stars, based on 1 article reviews
anova statgraphics centurion - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
statpoint inc variance analysis statgraphics centurion xvi.i
Fig. 2. Identification of DE-DRMs in individuals with EP. (A) The heatmap of expression levels for nine DE-DRMs. (B) The expression levels of 11 DRMs were exhibited between Ctrl and EP groups in boxplots. (C) Correlation analysis of nine DE-DRMs. Red and green colors represent positive and negative correlations, respectively. (D) The PPI analysis of DE-DMRs showed that SLC3A2 interacted with SLC7A11, while NDUFS1 interacted <t>with</t> <t>NDUFA11,</t> <t>NUBPL,</t> and LRPPRC. Abbreviations: DE-DRMs, differentially expressed disulfidptosis-related molecules; EP, epilepsy; Ctrl, control; PPI, protein-protein interaction; SLC3A2, solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; LRPPRC, leucine rich pentatricopeptide repeat containing. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Variance Analysis Statgraphics Centurion Xvi.I, supplied by statpoint inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/one-+or+two-way+anova/variance+analysis+one+way+anova+statgraphics+centurion+xvi+i/10__1051_slash_ctv_slash_20183302177-112-16-16
Average 90 stars, based on 1 article reviews
variance analysis statgraphics centurion xvi.i - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


(A) Schematic representation of the NOVA2 Human Untagged Clone (#SC303210, OriGene) containing the full-length NOVA2 cDNA (NM_002516) that we modified by inserting a 14×His-tag in-frame at the C-terminus of the NOVA2 open reading frame. The scheme illustrates the NOVA2 coding sequence (yellow), the inserted 14×His-tag (orange), followed by the stop codon (red). (B) hNSC co-overexpressing the non-pathogenic N(ATTTT) 7 , N(ATTTT) 139 or the pathogenic Ins(ATTTC) 58 sequences and NOVA2-His-tag, show aberrant nuclear AUUUC repeat aggregates that colocalize with NOVA2 (white arrows), but not AUUUU repeat accumulation, after staining with a specific FISH probe followed by immunofluorescence with the Anti-his-tag antibody, visible at 48 hours post-transfection. GFP expression was used as a marker for transfection. Images acquired in Leica Microsystems TCS SP5 II confocal microscope, using a HC PL APO Lbl. Blue 63× /1.40 Oil objective with 8× zoom. Scale bar = 2 µm.

Journal: bioRxiv

Article Title: The AUUUC repeat RNA aggregates sequester RNA-binding proteins like NOVA2 and lead to iron dyshomeostasis in spinocerebellar ataxia type 37

doi: 10.1101/2025.09.03.673996

Figure Lengend Snippet: (A) Schematic representation of the NOVA2 Human Untagged Clone (#SC303210, OriGene) containing the full-length NOVA2 cDNA (NM_002516) that we modified by inserting a 14×His-tag in-frame at the C-terminus of the NOVA2 open reading frame. The scheme illustrates the NOVA2 coding sequence (yellow), the inserted 14×His-tag (orange), followed by the stop codon (red). (B) hNSC co-overexpressing the non-pathogenic N(ATTTT) 7 , N(ATTTT) 139 or the pathogenic Ins(ATTTC) 58 sequences and NOVA2-His-tag, show aberrant nuclear AUUUC repeat aggregates that colocalize with NOVA2 (white arrows), but not AUUUU repeat accumulation, after staining with a specific FISH probe followed by immunofluorescence with the Anti-his-tag antibody, visible at 48 hours post-transfection. GFP expression was used as a marker for transfection. Images acquired in Leica Microsystems TCS SP5 II confocal microscope, using a HC PL APO Lbl. Blue 63× /1.40 Oil objective with 8× zoom. Scale bar = 2 µm.

Article Snippet: To create the NOVA2-His-tag expression vector, the NOVA2 Human Untagged Clone (#SC303210, Origene) vector was modified by a His-tag sequence of 14 histidines inserted, in frame, at the C-terminal of the NOVA2 by the in vivo assembly (IVA) cloning method ( ).

Techniques: Modification, Sequencing, Staining, Immunofluorescence, Transfection, Expressing, Marker, Microscopy

(A) Representative high-quality scans of HEK293T cells were analyzed under each experimental condition: cells co-expressing either the SCA37 pathogenic repeat insertion, Ins(ATTTC) 58 , or the non-pathogenic N(ATTTT) 7 and NOVA2-His-tag; cells expressing the non-pathogenic N(ATTTT) 7 and NOVA2-His-tag sequence, but with no NiCl supplementation; and mock-transfected cells (expressing no plasmids). The fluorescence images highlight the localization and expression patterns of iron (Fe) and nickel (Ni) under each condition. Zinc (Zn) delineates the nucleus and potassium (K) the cytoplasm. The X-Ray beam size was approximately 35 nm (horizontal) × 38 nm (vertical) at an excitation energy of 17.1 keV, with an X-Ray flux of 2×10 11 photons.s -1 . A dwell time of 50 ms.pixel −1 and a stepsize of 50 nm were used. (B) Pearson’s Correlation Coefficient for iron and nickel distribution was calculated for individual cells under each experimental condition. Statistical significance between the conditions was determined using a Mann-Whitney test, with a threshold of p<0.05 for significance. (C-F) Graphical representation of the concentration of (C) iron and (D) nickel, in the whole cell; and concentration of (E) iron and (F) nickel, in the nucleus. For (C), (D), (E) and (F), statistical significance was determined using One-Way ANOVA, with p<0.05 considered significant. Scale bar = 50 pixels.

Journal: bioRxiv

Article Title: The AUUUC repeat RNA aggregates sequester RNA-binding proteins like NOVA2 and lead to iron dyshomeostasis in spinocerebellar ataxia type 37

doi: 10.1101/2025.09.03.673996

Figure Lengend Snippet: (A) Representative high-quality scans of HEK293T cells were analyzed under each experimental condition: cells co-expressing either the SCA37 pathogenic repeat insertion, Ins(ATTTC) 58 , or the non-pathogenic N(ATTTT) 7 and NOVA2-His-tag; cells expressing the non-pathogenic N(ATTTT) 7 and NOVA2-His-tag sequence, but with no NiCl supplementation; and mock-transfected cells (expressing no plasmids). The fluorescence images highlight the localization and expression patterns of iron (Fe) and nickel (Ni) under each condition. Zinc (Zn) delineates the nucleus and potassium (K) the cytoplasm. The X-Ray beam size was approximately 35 nm (horizontal) × 38 nm (vertical) at an excitation energy of 17.1 keV, with an X-Ray flux of 2×10 11 photons.s -1 . A dwell time of 50 ms.pixel −1 and a stepsize of 50 nm were used. (B) Pearson’s Correlation Coefficient for iron and nickel distribution was calculated for individual cells under each experimental condition. Statistical significance between the conditions was determined using a Mann-Whitney test, with a threshold of p<0.05 for significance. (C-F) Graphical representation of the concentration of (C) iron and (D) nickel, in the whole cell; and concentration of (E) iron and (F) nickel, in the nucleus. For (C), (D), (E) and (F), statistical significance was determined using One-Way ANOVA, with p<0.05 considered significant. Scale bar = 50 pixels.

Article Snippet: To create the NOVA2-His-tag expression vector, the NOVA2 Human Untagged Clone (#SC303210, Origene) vector was modified by a His-tag sequence of 14 histidines inserted, in frame, at the C-terminal of the NOVA2 by the in vivo assembly (IVA) cloning method ( ).

Techniques: Expressing, Sequencing, Transfection, Fluorescence, MANN-WHITNEY, Concentration Assay

KEY RESOURCES TABLE

Journal: Cell

Article Title: Neuronal Inactivity Co-opts LTP Machinery to Drive Potassium Channel Splicing and Homeostatic Spike Widening

doi: 10.1016/j.cell.2020.05.013

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: This paper N/A Primers for RT-PCR and qPCR, see Table S1 This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: F: CCGGAATTCCGGC TATGTGGCAACCCTAC This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: R: CGCGGATCCGCGT CTCCTTTGACTTCCTCT This paper N/A Primers to measure E29 splicing in the splicing reporter: F: GGAGAAGTCTGCCGTTACTGCCC TGTG (DY-782 labeled) This paper N/A Primers to measure E29 splicing in the splicing reporter: R: CCGTCGTCCTTGAAGAAGATGGTGC This paper N/A Recombinant DNA mouse βCaMKK construct: Lentiviral CaMKKbeta Green et al., 2011b Addgene Plasmid #33322; RRID:Addgene_33322 rat βCaMKK 1–460 construct: pSG5-FLAG-CaMKKbeta rat 1–460 Green et al., 2011a Addgene Plasmid #33324; RRID:Addgene_33324 Human Nova-2 ORF Origene Cat# RC216200L1V, RC216200L2V pcDNA3-BK-GFP Li et al., 2014 N/A pCKII-GFP Li et al., 2016 N/A BK channel without E29 This paper N/A BK channel with E29 This paper N/A splice reporter pFlare5 vector Stoilov et al., 2008 N/A pGFP-C-shLenti βCaMKK shRNA constructs Origene Cat#TL711303 pGFP-C-shLenti Nova2 shRNA constructs Origene Cat#TL508674 pcDNA3.1/Puro-CAG-ASAP1 St-Pierre et al., 2014 Addgene Plasmid # 52519; RRID:Addgene_52519 AAV-CaMKIIa-GCaMP6s-P2A-nls-tdTomato Gift from Jonathan Ting (unpublished) Addgene Plasmid #51086; RRID:Addgene_51086 CaMKIV-GFP construct Gift from Haruhiko Bito N/A CA-CaMKIV construct Gifts from Tian-Ming Gao N/A CaMBP4 construct Gifts from Tian-Ming Gao N/A Software and Algorithms pClamp 9 Molecular Devices https://www.moleculardevices.com/ Prism GraphPad https://www.graphpad.com/ MATLAB Mathworks https://www.mathworks.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, Mutagenesis, Immunoprecipitation, Isolation, Protein Extraction, Lysis, Labeling, Construct, Plasmid Preparation, shRNA, Software

Fig. 3 MiR-7-5p directly targets NOVA2 expression. a – The sequence of human miR-7-p and the predicted binding sites with miR-7-5p within the NOVA2 untranslated region (3′-UTR) are shown. b – MiR-7-5p treatment suppressed NOVA2 expression in A549 and SPCA-1 cells. The cells were cultured with or without miR-7-5p for 24 h, and then collected and used for western blotting assays to determine NOVA2 expression. β-actin was set as a loading control. The quantitative data from western blotting assays were measured with ImageJ software. Data are ratios of NOVA2 to β-actin. c – MiR-7-5p stimulation inhibited NOVA2 mRNA in A549 and SPCA-1 cells. A549 cells were co-transfected with luciferase plasmids containing the wild-type (WT) NOVA2 3′-UTR or mutant-type (Mut) NOVA2 3′-UTR. The cells were also treated with miR-7-5p at the same time. The cells were lysed to measure the relative luciferase activity. Quantitative data are presented as the means ± SEM, n = 3. ***p < 0.001 compared with the NC mimic group. d – NOVA2 expression in NSCLC tissues and adjacent non-tumor tissues was measured using qPCR. Quantitative data are presented as the means ± SEM. ***p < 0.001 compared with the NC mimic group. e – NOVA2 expression in a panel of human lung cell lines and human lung epithelial BEAS-2B cells. NOVA2 expression in BEAS-2B cells was set as 100%. Quantitative data are presented as the means ± SEM, n = 3. ***p < 0.001 compared with the BEAS- 2B group. f – Analysis of the correlation between miR-7-5p and NOVA2 expression in tumors. NOVA2 expression was inversely correlated with miR-7-5p expression in NSCLC tissues. The miR-206 mRNA level was set as the X axes, and the TFR1 mRNA level was set as the Y axes. R stands for goodness of fit. The p value stands for slope significance

Journal: Cellular & molecular biology letters

Article Title: MiR-7-5p suppresses tumor metastasis of non-small cell lung cancer by targeting NOVA2.

doi: 10.1186/s11658-019-0188-3

Figure Lengend Snippet: Fig. 3 MiR-7-5p directly targets NOVA2 expression. a – The sequence of human miR-7-p and the predicted binding sites with miR-7-5p within the NOVA2 untranslated region (3′-UTR) are shown. b – MiR-7-5p treatment suppressed NOVA2 expression in A549 and SPCA-1 cells. The cells were cultured with or without miR-7-5p for 24 h, and then collected and used for western blotting assays to determine NOVA2 expression. β-actin was set as a loading control. The quantitative data from western blotting assays were measured with ImageJ software. Data are ratios of NOVA2 to β-actin. c – MiR-7-5p stimulation inhibited NOVA2 mRNA in A549 and SPCA-1 cells. A549 cells were co-transfected with luciferase plasmids containing the wild-type (WT) NOVA2 3′-UTR or mutant-type (Mut) NOVA2 3′-UTR. The cells were also treated with miR-7-5p at the same time. The cells were lysed to measure the relative luciferase activity. Quantitative data are presented as the means ± SEM, n = 3. ***p < 0.001 compared with the NC mimic group. d – NOVA2 expression in NSCLC tissues and adjacent non-tumor tissues was measured using qPCR. Quantitative data are presented as the means ± SEM. ***p < 0.001 compared with the NC mimic group. e – NOVA2 expression in a panel of human lung cell lines and human lung epithelial BEAS-2B cells. NOVA2 expression in BEAS-2B cells was set as 100%. Quantitative data are presented as the means ± SEM, n = 3. ***p < 0.001 compared with the BEAS- 2B group. f – Analysis of the correlation between miR-7-5p and NOVA2 expression in tumors. NOVA2 expression was inversely correlated with miR-7-5p expression in NSCLC tissues. The miR-206 mRNA level was set as the X axes, and the TFR1 mRNA level was set as the Y axes. R stands for goodness of fit. The p value stands for slope significance

Article Snippet: The NC and NOVA2 vectors were purchased from Origene.

Techniques: Expressing, Sequencing, Binding Assay, Cell Culture, Western Blot, Control, Software, Transfection, Luciferase, Mutagenesis, Activity Assay

Fig. 4 NOVA2 overexpression reverses the inhibitory effect of miR-7-5p on A549 and SPCA-1 cells. a – NOVA2 overexpression partly decreased the miR-7-5p-mediated inhibitory effect on the proliferation of A549 and SPCA-1 cells. b and c – NOVA2 expression weakened the miR-7-5p-induced inhibitory effect on the migration of A549 and SPCA-1 cells. A549 and SPCA-1 cells were transfected with NOVA2 vector. After 24 h, the transfected cells were used for wound-healing assays. Representative images and quantitative data are shown in B and C, respectively. d and e – NOVA2 overexpression attenuated the miR-7-5p-mediated effect on the invasion of A549 and SPCA-1 cells. Representative images and quantitative data are shown in D and E, respectively. Quantitative data are presented as the means ± SEM. ***p < 0.001 compared with NC vector group. f – NOVA2 overexpression blocked miR-7-5p-mediated downregulation of EMT markers. A549 and SPCA-1 cells were transfected with NOVA2 vector or NC vector and then treated with miR-7-5p for 24 h. After that, the cells were collected and used for western blotting assays. The quantitative data from western blotting assays were measured with ImageJ software. Data are ratios of respective EMT marker to β-actin

Journal: Cellular & molecular biology letters

Article Title: MiR-7-5p suppresses tumor metastasis of non-small cell lung cancer by targeting NOVA2.

doi: 10.1186/s11658-019-0188-3

Figure Lengend Snippet: Fig. 4 NOVA2 overexpression reverses the inhibitory effect of miR-7-5p on A549 and SPCA-1 cells. a – NOVA2 overexpression partly decreased the miR-7-5p-mediated inhibitory effect on the proliferation of A549 and SPCA-1 cells. b and c – NOVA2 expression weakened the miR-7-5p-induced inhibitory effect on the migration of A549 and SPCA-1 cells. A549 and SPCA-1 cells were transfected with NOVA2 vector. After 24 h, the transfected cells were used for wound-healing assays. Representative images and quantitative data are shown in B and C, respectively. d and e – NOVA2 overexpression attenuated the miR-7-5p-mediated effect on the invasion of A549 and SPCA-1 cells. Representative images and quantitative data are shown in D and E, respectively. Quantitative data are presented as the means ± SEM. ***p < 0.001 compared with NC vector group. f – NOVA2 overexpression blocked miR-7-5p-mediated downregulation of EMT markers. A549 and SPCA-1 cells were transfected with NOVA2 vector or NC vector and then treated with miR-7-5p for 24 h. After that, the cells were collected and used for western blotting assays. The quantitative data from western blotting assays were measured with ImageJ software. Data are ratios of respective EMT marker to β-actin

Article Snippet: The NC and NOVA2 vectors were purchased from Origene.

Techniques: Over Expression, Expressing, Migration, Transfection, Plasmid Preparation, Western Blot, Software, Marker

KEY RESOURCES TABLE

Journal: Cell

Article Title: Neuronal Inactivity Co-opts LTP Machinery to Drive Potassium Channel Splicing and Homeostatic Spike Widening

doi: 10.1016/j.cell.2020.05.013

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: This paper N/A Primers for RT-PCR and qPCR, see Table S1 This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: F: CCGGAATTCCGGC TATGTGGCAACCCTAC This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: R: CGCGGATCCGCGT CTCCTTTGACTTCCTCT This paper N/A Primers to measure E29 splicing in the splicing reporter: F: GGAGAAGTCTGCCGTTACTGCCC TGTG (DY-782 labeled) This paper N/A Primers to measure E29 splicing in the splicing reporter: R: CCGTCGTCCTTGAAGAAGATGGTGC This paper N/A Recombinant DNA mouse βCaMKK construct: Lentiviral CaMKKbeta Green et al., 2011b Addgene Plasmid #33322; RRID:Addgene_33322 rat βCaMKK 1–460 construct: pSG5-FLAG-CaMKKbeta rat 1–460 Green et al., 2011a Addgene Plasmid #33324; RRID:Addgene_33324 Human Nova-2 ORF Origene Cat# RC216200L1V, RC216200L2V pcDNA3-BK-GFP Li et al., 2014 N/A pCKII-GFP Li et al., 2016 N/A BK channel without E29 This paper N/A BK channel with E29 This paper N/A splice reporter pFlare5 vector Stoilov et al., 2008 N/A pGFP-C-shLenti βCaMKK shRNA constructs Origene Cat#TL711303 pGFP-C-shLenti Nova2 shRNA constructs Origene Cat#TL508674 pcDNA3.1/Puro-CAG-ASAP1 St-Pierre et al., 2014 Addgene Plasmid # 52519; RRID:Addgene_52519 AAV-CaMKIIa-GCaMP6s-P2A-nls-tdTomato Gift from Jonathan Ting (unpublished) Addgene Plasmid #51086; RRID:Addgene_51086 CaMKIV-GFP construct Gift from Haruhiko Bito N/A CA-CaMKIV construct Gifts from Tian-Ming Gao N/A CaMBP4 construct Gifts from Tian-Ming Gao N/A Software and Algorithms pClamp 9 Molecular Devices https://www.moleculardevices.com/ Prism GraphPad https://www.graphpad.com/ MATLAB Mathworks https://www.mathworks.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, Mutagenesis, Immunoprecipitation, Isolation, Protein Extraction, Lysis, Labeling, Construct, Plasmid Preparation, shRNA, Software

Fig. 2. Identification of DE-DRMs in individuals with EP. (A) The heatmap of expression levels for nine DE-DRMs. (B) The expression levels of 11 DRMs were exhibited between Ctrl and EP groups in boxplots. (C) Correlation analysis of nine DE-DRMs. Red and green colors represent positive and negative correlations, respectively. (D) The PPI analysis of DE-DMRs showed that SLC3A2 interacted with SLC7A11, while NDUFS1 interacted with NDUFA11, NUBPL, and LRPPRC. Abbreviations: DE-DRMs, differentially expressed disulfidptosis-related molecules; EP, epilepsy; Ctrl, control; PPI, protein-protein interaction; SLC3A2, solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; LRPPRC, leucine rich pentatricopeptide repeat containing. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Journal: Neurobiology of disease

Article Title: Identifying disulfidptosis-related biomarkers in epilepsy based on integrated bioinformatics and experimental analyses.

doi: 10.1016/j.nbd.2025.106789

Figure Lengend Snippet: Fig. 2. Identification of DE-DRMs in individuals with EP. (A) The heatmap of expression levels for nine DE-DRMs. (B) The expression levels of 11 DRMs were exhibited between Ctrl and EP groups in boxplots. (C) Correlation analysis of nine DE-DRMs. Red and green colors represent positive and negative correlations, respectively. (D) The PPI analysis of DE-DMRs showed that SLC3A2 interacted with SLC7A11, while NDUFS1 interacted with NDUFA11, NUBPL, and LRPPRC. Abbreviations: DE-DRMs, differentially expressed disulfidptosis-related molecules; EP, epilepsy; Ctrl, control; PPI, protein-protein interaction; SLC3A2, solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; LRPPRC, leucine rich pentatricopeptide repeat containing. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: The paraffin sections were incubated with the primary antibodies (overnight, 4 ◦C): anti-GYS1 antibody (Sangon Biotech, D122431, dilution: 1:100), anti-NDUFS1 antibody (Abcam, ab185733, dilution: 1:100), anti-OXSM antibody (Boster, A12866–1, dilution: 1:100), anti-LRPPRC antibody (Abcam, ab259927, dilution: 1:200), anti-NDUFA11 antibody (Abclonal, A16239, dilution: 1:100) (Yang et al., 2022), anti-NUBPL antibody (Boster, A10634–1, dilution: 1:100), anti-NCKAP1 antibody (Bioworld Technology, BS71703, dilution: 1:50), anti-SLC3A2 antibody (Santa, sc-390,154, dilution: 1:50), anti-SLC7A11 antibody (Abcam, ab307601. dilution: 1:500).

Techniques: Expressing, Control

Fig. 8. The expression of DE-DRMs in seizures models (in vitro and in vivo). (A) Constructing the in vitro seizures model. The amplitude and frequency of neuronal APs in the Mg2+-free group were significantly increased (n = 6 in each group; Independent sample t-test; #, P < 0.01). (B) Protein expression of nine DE-DRMs in the in vitro seizures model. The expression of GYS1, NDUFS1, OXSM, LRPPRC, NDUFA11, NUBPL, NCKAP1, and SLC3A2 were not significantly changed in the Mg2+-free group, while the expression of SLC7A11 was significantly increased in Mg2+-free group (n = 6 in each group; Independent sample t-test; #, P < 0.01). (C) Con structing the in vivo seizures model. No epileptoid discharges were observed in six rats of the Ctrl group, while significant epileptoid discharges were observed in six rats of the PTZ group (scale: Y-axis,50uV; X-axis, 0.5 s). (D) Protein expression of nine DE-DRMs in vivo models. The expressions of GYS1, NDUFS1, OXSM, LRPPRC, NDUFA11, NUBPL, NCKAP1, and SLC3A2 were not significantly changed in PTZ group, while the expression of SLC7A11 was significantly increased in PTZ group (n = 6 in each group; Independent sample t-test; #, P < 0.01). Abbreviations: DE-DRMs, differentially expressed disulfidptosis-related molecules; APs, action potentials; GYS1, glycogen synthase 1; SLC3A2, solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; OXSM, 3-oxoacyl-ACP synthase, mitochondrial; LRPPRC, leucine rich pentatricopeptide repeat containing; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; NCKAP1, NCK associated protein 1; PTZ, pentylenetetrazol.

Journal: Neurobiology of disease

Article Title: Identifying disulfidptosis-related biomarkers in epilepsy based on integrated bioinformatics and experimental analyses.

doi: 10.1016/j.nbd.2025.106789

Figure Lengend Snippet: Fig. 8. The expression of DE-DRMs in seizures models (in vitro and in vivo). (A) Constructing the in vitro seizures model. The amplitude and frequency of neuronal APs in the Mg2+-free group were significantly increased (n = 6 in each group; Independent sample t-test; #, P < 0.01). (B) Protein expression of nine DE-DRMs in the in vitro seizures model. The expression of GYS1, NDUFS1, OXSM, LRPPRC, NDUFA11, NUBPL, NCKAP1, and SLC3A2 were not significantly changed in the Mg2+-free group, while the expression of SLC7A11 was significantly increased in Mg2+-free group (n = 6 in each group; Independent sample t-test; #, P < 0.01). (C) Con structing the in vivo seizures model. No epileptoid discharges were observed in six rats of the Ctrl group, while significant epileptoid discharges were observed in six rats of the PTZ group (scale: Y-axis,50uV; X-axis, 0.5 s). (D) Protein expression of nine DE-DRMs in vivo models. The expressions of GYS1, NDUFS1, OXSM, LRPPRC, NDUFA11, NUBPL, NCKAP1, and SLC3A2 were not significantly changed in PTZ group, while the expression of SLC7A11 was significantly increased in PTZ group (n = 6 in each group; Independent sample t-test; #, P < 0.01). Abbreviations: DE-DRMs, differentially expressed disulfidptosis-related molecules; APs, action potentials; GYS1, glycogen synthase 1; SLC3A2, solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; OXSM, 3-oxoacyl-ACP synthase, mitochondrial; LRPPRC, leucine rich pentatricopeptide repeat containing; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; NCKAP1, NCK associated protein 1; PTZ, pentylenetetrazol.

Article Snippet: The paraffin sections were incubated with the primary antibodies (overnight, 4 ◦C): anti-GYS1 antibody (Sangon Biotech, D122431, dilution: 1:100), anti-NDUFS1 antibody (Abcam, ab185733, dilution: 1:100), anti-OXSM antibody (Boster, A12866–1, dilution: 1:100), anti-LRPPRC antibody (Abcam, ab259927, dilution: 1:200), anti-NDUFA11 antibody (Abclonal, A16239, dilution: 1:100) (Yang et al., 2022), anti-NUBPL antibody (Boster, A10634–1, dilution: 1:100), anti-NCKAP1 antibody (Bioworld Technology, BS71703, dilution: 1:50), anti-SLC3A2 antibody (Santa, sc-390,154, dilution: 1:50), anti-SLC7A11 antibody (Abcam, ab307601. dilution: 1:500).

Techniques: Expressing, In Vitro, In Vivo

Fig. 9. Verifying the PPI in seizures models (in vivo and in vitro). (A-B) colocation analysis indicated that SLC7A11 colocalized with SLC3A2, NDUFS1 colocalized with LRPPRC, NDUFS1 colocalized with NUBPL, and NDUFS1 colocalized with NDUFA11 in both primary neurons and hippocampal tissue. (C–D) Pooled quan tification of protein immunoprecipitation showed a significant increment in the pull-down of SLC7A11 and a significant reduction in the pull-down of NDUFA11 in both the Mg2+-free group and PTZ group (n = 6 in each group; Independent sample t-test; #, P < 0.01). Abbreviations: PPI, protein-protein interaction; SLC3A2,solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; LRPPRC, leucine rich pentatricopeptide repeat containing; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; PTZ, pentylenetetrazol.

Journal: Neurobiology of disease

Article Title: Identifying disulfidptosis-related biomarkers in epilepsy based on integrated bioinformatics and experimental analyses.

doi: 10.1016/j.nbd.2025.106789

Figure Lengend Snippet: Fig. 9. Verifying the PPI in seizures models (in vivo and in vitro). (A-B) colocation analysis indicated that SLC7A11 colocalized with SLC3A2, NDUFS1 colocalized with LRPPRC, NDUFS1 colocalized with NUBPL, and NDUFS1 colocalized with NDUFA11 in both primary neurons and hippocampal tissue. (C–D) Pooled quan tification of protein immunoprecipitation showed a significant increment in the pull-down of SLC7A11 and a significant reduction in the pull-down of NDUFA11 in both the Mg2+-free group and PTZ group (n = 6 in each group; Independent sample t-test; #, P < 0.01). Abbreviations: PPI, protein-protein interaction; SLC3A2,solute carrier family 3 member 2; SLC7A11, solute carrier family 7 member 11; NDUFS1, NADH:ubiquinone oxidoreductase core subunit S1; LRPPRC, leucine rich pentatricopeptide repeat containing; NUBPL, NUBP iron‑sulfur cluster assembly factor, mitochondrial; NDUFA11, NADH:ubiquinone oxidoreductase subunit A11; PTZ, pentylenetetrazol.

Article Snippet: The paraffin sections were incubated with the primary antibodies (overnight, 4 ◦C): anti-GYS1 antibody (Sangon Biotech, D122431, dilution: 1:100), anti-NDUFS1 antibody (Abcam, ab185733, dilution: 1:100), anti-OXSM antibody (Boster, A12866–1, dilution: 1:100), anti-LRPPRC antibody (Abcam, ab259927, dilution: 1:200), anti-NDUFA11 antibody (Abclonal, A16239, dilution: 1:100) (Yang et al., 2022), anti-NUBPL antibody (Boster, A10634–1, dilution: 1:100), anti-NCKAP1 antibody (Bioworld Technology, BS71703, dilution: 1:50), anti-SLC3A2 antibody (Santa, sc-390,154, dilution: 1:50), anti-SLC7A11 antibody (Abcam, ab307601. dilution: 1:500).

Techniques: In Vivo, In Vitro, Immunoprecipitation